Transcript: Human NM_001349442.2

Homo sapiens nei like DNA glycosylase 2 (NEIL2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
NEIL2 (252969)
Length:
2317
CDS:
247..1245

Additional Resources:

NCBI RefSeq record:
NM_001349442.2
NBCI Gene record:
NEIL2 (252969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416753 TCAGAGGTGCCAGTAGTATAA pLKO_005 1352 3UTR 100% 13.200 18.480 N NEIL2 n/a
2 TRCN0000064013 CGTGTCAGCTTTGGTTTGTTT pLKO.1 640 CDS 100% 5.625 7.875 N NEIL2 n/a
3 TRCN0000422034 GACGTCTAAGTGTCCAGAAAG pLKO_005 1291 3UTR 100% 10.800 7.560 N NEIL2 n/a
4 TRCN0000064014 GCTAGGGAACATCATTAAGAA pLKO.1 930 CDS 100% 5.625 3.938 N NEIL2 n/a
5 TRCN0000439244 ACGTGGTGGAGTTCAGTACAG pLKO_005 1034 CDS 100% 4.050 2.835 N NEIL2 n/a
6 TRCN0000064017 CCATGGAAAGAAATTATTCCT pLKO.1 387 CDS 100% 3.000 2.100 N NEIL2 n/a
7 TRCN0000064016 CATCATTAAGAATGAAGCCTT pLKO.1 939 CDS 100% 2.640 1.848 N NEIL2 n/a
8 TRCN0000064015 GAACGATTTCTCCAGAGCCAA pLKO.1 675 CDS 100% 2.640 1.848 N NEIL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349442.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.