Transcript: Human NM_001349550.2

Homo sapiens terminal nucleotidyltransferase 2 (TENT2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TENT2 (167153)
Length:
4970
CDS:
468..1997

Additional Resources:

NCBI RefSeq record:
NM_001349550.2
NBCI Gene record:
TENT2 (167153)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142868 CCCATTATTTCGAGGAAGGAA pLKO.1 674 CDS 100% 3.000 4.200 N TENT2 n/a
2 TRCN0000352813 CCCATTATTTCGAGGAAGGAA pLKO_005 674 CDS 100% 3.000 4.200 N TENT2 n/a
3 TRCN0000139535 CGGAGCAGTGATGGTGATTTA pLKO.1 1095 CDS 100% 13.200 9.240 N TENT2 n/a
4 TRCN0000144693 GCAACAGAAACTGAGATCAAA pLKO.1 2831 3UTR 100% 5.625 3.938 N TENT2 n/a
5 TRCN0000343260 GCAACAGAAACTGAGATCAAA pLKO_005 2831 3UTR 100% 5.625 3.938 N TENT2 n/a
6 TRCN0000145423 GCACTAACTCTTACAACAGTT pLKO.1 2675 3UTR 100% 4.950 3.465 N TENT2 n/a
7 TRCN0000343259 GCACTAACTCTTACAACAGTT pLKO_005 2675 3UTR 100% 4.950 3.465 N TENT2 n/a
8 TRCN0000139631 CCAAGGCCTGATGGTATTGAA pLKO.1 1794 CDS 100% 5.625 3.375 N TENT2 n/a
9 TRCN0000343258 CCAAGGCCTGATGGTATTGAA pLKO_005 1794 CDS 100% 5.625 3.375 N TENT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349550.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.