Transcript: Human NM_001349923.1

Homo sapiens tudor domain containing 5 (TDRD5), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-02-26
Taxon:
Homo sapiens (human)
Gene:
TDRD5 (163589)
Length:
3502
CDS:
228..3173

Additional Resources:

NCBI RefSeq record:
NM_001349923.1
NBCI Gene record:
TDRD5 (163589)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435777 TAAGGGAAGACCTAGTATTTA pLKO_005 542 CDS 100% 15.000 21.000 N TDRD5 n/a
2 TRCN0000158478 CCGTGCTATTACATTGTACAA pLKO.1 2972 CDS 100% 4.950 6.930 N TDRD5 n/a
3 TRCN0000161485 GCTTGGAGAGTATGAGGTAAT pLKO.1 1184 CDS 100% 10.800 8.640 N TDRD5 n/a
4 TRCN0000160581 CCTCAAACGAAGATGTCTATT pLKO.1 2146 CDS 100% 13.200 9.240 N TDRD5 n/a
5 TRCN0000161880 GAAGTGTTCTACCCAGACTTT pLKO.1 1896 CDS 100% 4.950 3.465 N TDRD5 n/a
6 TRCN0000165922 GCTGCTGTCAAAGAGACTGTA pLKO.1 1422 CDS 100% 4.950 3.465 N TDRD5 n/a
7 TRCN0000158897 GCTTTATTATGCTAACAGTCT pLKO.1 3310 3UTR 100% 2.640 1.848 N TDRD5 n/a
8 TRCN0000159561 GTCTACTTTGATGTGTAAGTA pLKO.1 3327 3UTR 100% 0.563 0.394 N TDRD5 n/a
9 TRCN0000412368 TATCATCTCTCCTAGTCAATT pLKO_005 1664 CDS 100% 13.200 7.920 N TDRD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.