Transcript: Human NM_001350295.1

Homo sapiens guided entry of tail-anchored proteins factor 1 (GET1), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
GET1 (7485)
Length:
1562
CDS:
190..612

Additional Resources:

NCBI RefSeq record:
NM_001350295.1
NBCI Gene record:
GET1 (7485)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133708 GTTGGAATTACCTGTTGGATT pLKO.1 544 CDS 100% 4.950 3.960 N GET1 n/a
2 TRCN0000349733 GTTGGAATTACCTGTTGGATT pLKO_005 544 CDS 100% 4.950 3.960 N GET1 n/a
3 TRCN0000135744 CCATGCTGTCACTTGTGATTT pLKO.1 889 3UTR 100% 13.200 9.240 N GET1 n/a
4 TRCN0000312564 CCATGCTGTCACTTGTGATTT pLKO_005 889 3UTR 100% 13.200 9.240 N GET1 n/a
5 TRCN0000138817 GCCCTGATGATCTCACTCATT pLKO.1 427 CDS 100% 4.950 2.475 Y GET1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.