Transcript: Human NM_001350430.2

Homo sapiens regulating synaptic membrane exocytosis 1 (RIMS1), transcript variant 26, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RIMS1 (22999)
Length:
5272
CDS:
388..2841

Additional Resources:

NCBI RefSeq record:
NM_001350430.2
NBCI Gene record:
RIMS1 (22999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230755 GATGAACCGCATTGGTATAAA pLKO_005 1318 CDS 100% 15.000 21.000 N RIMS1 n/a
2 TRCN0000230754 CCGATTAATTGGACGTGTTAT pLKO_005 522 CDS 100% 13.200 18.480 N RIMS1 n/a
3 TRCN0000001728 CGTCCTCGAAATCCCTATGTA pLKO.1 1066 CDS 100% 5.625 7.875 N RIMS1 n/a
4 TRCN0000381924 TACAGCTCTGAGGGCAATTTA pLKO_005 2251 CDS 100% 15.000 10.500 N RIMS1 n/a
5 TRCN0000218005 AGAAGTCAATCTGCAACTAAT pLKO_005 3678 3UTR 100% 13.200 9.240 N RIMS1 n/a
6 TRCN0000218860 GAACAAGGCAATCTATCAAAT pLKO_005 3016 3UTR 100% 13.200 9.240 N RIMS1 n/a
7 TRCN0000381398 CCGAAGTCCAGTTGATCATAG pLKO_005 1728 CDS 100% 10.800 7.560 N RIMS1 n/a
8 TRCN0000001729 CCCGAAGTCCAGTTGATCATA pLKO.1 1727 CDS 100% 5.625 3.938 N RIMS1 n/a
9 TRCN0000001730 CCGGGAGCTACAAATGAAGAA pLKO.1 733 CDS 100% 4.950 3.465 N RIMS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.