Transcript: Human NM_001350489.2

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1 like (MTHFD1L), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MTHFD1L (25902)
Length:
926
CDS:
122..847

Additional Resources:

NCBI RefSeq record:
NM_001350489.2
NBCI Gene record:
MTHFD1L (25902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229787 AGCAGTGAAGCCGAGATTATA pLKO_005 524 CDS 100% 15.000 10.500 N MTHFD1L n/a
2 TRCN0000217958 GTCTGAACATCACTCACATTT pLKO_005 489 CDS 100% 13.200 9.240 N MTHFD1L n/a
3 TRCN0000045400 GCCAAAGCTGTAATTGAACTT pLKO.1 731 CDS 100% 4.950 3.465 N MTHFD1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.