Transcript: Human NM_001350860.2

Homo sapiens kyphoscoliosis peptidase (KY), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KY (339855)
Length:
3735
CDS:
63..1271

Additional Resources:

NCBI RefSeq record:
NM_001350860.2
NBCI Gene record:
KY (339855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147116 CCTCTACAATGAGTTCTACTT pLKO.1 833 CDS 100% 4.950 6.930 N KY n/a
2 TRCN0000147147 CAGCAGTTTGAGAAATTGGAT pLKO.1 384 CDS 100% 3.000 2.400 N KY n/a
3 TRCN0000418126 GGGATCGATCTAGCCTGAAAT pLKO_005 346 CDS 100% 13.200 9.240 N KY n/a
4 TRCN0000419864 TAAACGTTTACAAGGTGATAA pLKO_005 269 CDS 100% 13.200 9.240 N KY n/a
5 TRCN0000130490 GAGGCAGTTTGAGAACAACAT pLKO.1 935 CDS 100% 4.950 3.465 N KY n/a
6 TRCN0000131189 GAGTTTGACCATGCCTGGAAT pLKO.1 726 CDS 100% 4.950 3.465 N KY n/a
7 TRCN0000149740 GCCATCACATAGAGTATGACA pLKO.1 517 CDS 100% 3.000 2.100 N KY n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350860.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.