Transcript: Human NM_001351485.2

Homo sapiens solute carrier family 8 member A1 (SLC8A1), transcript variant H, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SLC8A1 (6546)
Length:
21070
CDS:
250..3087

Additional Resources:

NCBI RefSeq record:
NM_001351485.2
NBCI Gene record:
SLC8A1 (6546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043947 CCTGAGATTCTCCTTTCAGTA pLKO.1 688 CDS 100% 4.950 6.930 N SLC8A1 n/a
2 TRCN0000043946 GCCCTGTTATTGAATGAGCTT pLKO.1 2164 CDS 100% 2.640 3.696 N SLC8A1 n/a
3 TRCN0000043944 GCCATCTTCTAAGACTGAAAT pLKO.1 1095 CDS 100% 13.200 9.240 N SLC8A1 n/a
4 TRCN0000043943 GAAACTGACATTTGTCATGTT pLKO.1 3159 3UTR 100% 4.950 3.465 N SLC8A1 n/a
5 TRCN0000043945 GCTAGGATTCTGAAGGAACTT pLKO.1 1228 CDS 100% 4.950 3.465 N SLC8A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351485.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.