Transcript: Human NM_001351694.2

Homo sapiens pleckstrin homology and RhoGEF domain containing G2 (PLEKHG2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PLEKHG2 (64857)
Length:
4990
CDS:
136..1869

Additional Resources:

NCBI RefSeq record:
NM_001351694.2
NBCI Gene record:
PLEKHG2 (64857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005469 CTACACATTGTACTGCATGAA pLKO.1 699 CDS 100% 4.950 3.465 N PLEKHG2 n/a
2 TRCN0000005467 GCAAAGCAAGTTCTCCTTGAA pLKO.1 1399 CDS 100% 4.950 3.465 N PLEKHG2 n/a
3 TRCN0000005466 CCCTCAGAACTTGACCTGGAA pLKO.1 1921 3UTR 100% 2.640 1.848 N PLEKHG2 n/a
4 TRCN0000418017 TCCATTCCCTTGGCAATTTAT pLKO_005 2315 3UTR 100% 15.000 9.000 N PLEKHG2 n/a
5 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 4515 3UTR 100% 4.950 2.475 Y GJD4 n/a
6 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 4515 3UTR 100% 4.950 2.475 Y C9orf85 n/a
7 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3510 3UTR 100% 4.950 2.475 Y C16orf89 n/a
8 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 4002 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351694.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.