Transcript: Human NM_001352051.2

Homo sapiens EMAP like 2 (EML2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
EML2 (24139)
Length:
1954
CDS:
90..1691

Additional Resources:

NCBI RefSeq record:
NM_001352051.2
NBCI Gene record:
EML2 (24139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294451 TTGCCGAGTAGAGTAATATAT pLKO_005 1749 3UTR 100% 15.000 21.000 N EML2 n/a
2 TRCN0000294449 GTGGGCTTCTCCAAATCTAAT pLKO_005 234 CDS 100% 13.200 18.480 N EML2 n/a
3 TRCN0000116539 GCTACTTGTGTCCTAGGGTTT pLKO.1 1404 CDS 100% 4.050 5.670 N EML2 n/a
4 TRCN0000294452 GCTTATCACCTGCGGGAAATC pLKO_005 401 CDS 100% 10.800 7.560 N EML2 n/a
5 TRCN0000294450 GGATAAGCTGGTGCATCTATG pLKO_005 932 CDS 100% 10.800 7.560 N EML2 n/a
6 TRCN0000116537 CTGACATACAGAAGTCTCTAT pLKO.1 1819 3UTR 100% 4.950 3.465 N EML2 n/a
7 TRCN0000116540 CGACAACTTGGTGTACGTGTA pLKO.1 1181 CDS 100% 4.050 2.835 N EML2 n/a
8 TRCN0000286995 CGACAACTTGGTGTACGTGTA pLKO_005 1181 CDS 100% 4.050 2.835 N EML2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.