Transcript: Human NM_001353345.1

Homo sapiens SET domain containing 1B, histone lysine methyltransferase (SETD1B), mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
SETD1B (23067)
Length:
8332
CDS:
15..5915

Additional Resources:

NCBI RefSeq record:
NM_001353345.1
NBCI Gene record:
SETD1B (23067)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237963 GCCGCCACGAACATCATTATG pLKO_005 982 CDS 100% 13.200 18.480 N SETD1B n/a
2 TRCN0000237965 GCTTGTAGAGACGGCTGATTC pLKO_005 7768 3UTR 100% 10.800 15.120 N SETD1B n/a
3 TRCN0000237962 GGAGATTACCTATGACTATAA pLKO_005 5825 CDS 100% 13.200 9.240 N SETD1B n/a
4 TRCN0000237966 TCGAGTACGTGGGCCAGAATA pLKO_005 5575 CDS 100% 13.200 9.240 N SETD1B n/a
5 TRCN0000237964 ACATGCGGGAGAAGCGTTATG pLKO_005 5614 CDS 100% 10.800 6.480 N SETD1B n/a
6 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 3574 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353345.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.