Transcript: Human NM_001353811.2

Homo sapiens ATPase phospholipid transporting 11C (ATP11C), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ATP11C (286410)
Length:
7005
CDS:
1012..4389

Additional Resources:

NCBI RefSeq record:
NM_001353811.2
NBCI Gene record:
ATP11C (286410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101851 GCCTATGTTATTGTCCTACAA pLKO.1 4408 3UTR 100% 4.950 6.930 N Atp11c n/a
2 TRCN0000052115 GCGAATCAATATCTACAGTAA pLKO.1 1680 CDS 100% 4.950 6.930 N ATP11C n/a
3 TRCN0000052114 CCCTTCTTATATTGGACATTT pLKO.1 3874 CDS 100% 13.200 10.560 N ATP11C n/a
4 TRCN0000052116 CGGCGACGTATGAGTGTAATT pLKO.1 2641 CDS 100% 13.200 9.240 N ATP11C n/a
5 TRCN0000052117 CCTGAGATTCTTCTGATAGTA pLKO.1 4249 CDS 100% 5.625 3.938 N ATP11C n/a
6 TRCN0000052113 GCTCAAATTCAGAATGGCAAT pLKO.1 6365 3UTR 100% 4.050 2.835 N ATP11C n/a
7 TRCN0000101852 GCTTTGAACTACCAAGGGAAA pLKO.1 1822 CDS 100% 4.050 2.835 N Atp11c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.