Transcript: Human NM_001353882.2

Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TM6SF1 (53346)
Length:
2052
CDS:
648..1316

Additional Resources:

NCBI RefSeq record:
NM_001353882.2
NBCI Gene record:
TM6SF1 (53346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001353882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423689 GAAGTATGGAACACGAATTTG pLKO_005 686 CDS 100% 13.200 18.480 N TM6SF1 n/a
2 TRCN0000138288 CCGTATCTGAACACCGCATAT pLKO.1 451 5UTR 100% 10.800 15.120 N TM6SF1 n/a
3 TRCN0000134976 CTGCCGATTATATACGCAATT pLKO.1 938 CDS 100% 10.800 15.120 N TM6SF1 n/a
4 TRCN0000421121 CACTGTATGTGTGAGCTATAT pLKO_005 1440 3UTR 100% 13.200 9.240 N TM6SF1 n/a
5 TRCN0000133980 CCATTTCACTCTCTTCTCATA pLKO.1 1384 3UTR 100% 4.950 3.465 N TM6SF1 n/a
6 TRCN0000134931 CCCTCAAAGGTTATTCAAGAA pLKO.1 798 CDS 100% 4.950 3.465 N TM6SF1 n/a
7 TRCN0000135885 GCTCTGCTCATTATCTGATGT pLKO.1 497 5UTR 100% 4.950 3.465 N TM6SF1 n/a
8 TRCN0000137625 GCTTAGTGGTTCCTGGATGTT pLKO.1 1057 CDS 100% 4.950 3.465 N TM6SF1 n/a
9 TRCN0000135809 CCACTGTTCTATGTGTATGCA pLKO.1 334 5UTR 100% 3.000 2.100 N TM6SF1 n/a
10 TRCN0000137796 GAACACGAATTTGCCCTGCTT pLKO.1 694 CDS 100% 2.640 1.848 N TM6SF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001353882.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.