Transcript: Human NM_001354259.2

Homo sapiens euchromatic histone lysine methyltransferase 1 (EHMT1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
EHMT1 (79813)
Length:
4585
CDS:
54..2531

Additional Resources:

NCBI RefSeq record:
NM_001354259.2
NBCI Gene record:
EHMT1 (79813)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036054 CGAGTCAATAACGCCAGCTAT pLKO.1 1818 CDS 100% 4.950 6.930 N EHMT1 n/a
2 TRCN0000036056 GCAACGGATACATCTTAAATA pLKO.1 325 CDS 100% 15.000 12.000 N EHMT1 n/a
3 TRCN0000036057 CCTCGGTTCTGAGTCGTATAA pLKO.1 1325 CDS 100% 13.200 9.240 N EHMT1 n/a
4 TRCN0000229325 CCTCGGTTCTGAGTCGTATAA pLKO_005 1325 CDS 100% 13.200 9.240 N EHMT1 n/a
5 TRCN0000217965 TCGAGAAGCTAGAGATCATAA pLKO_005 632 CDS 100% 13.200 9.240 N EHMT1 n/a
6 TRCN0000433423 CAAACAGCGTGGTCAAGTATG pLKO_005 1621 CDS 100% 10.800 7.560 N Ehmt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354259.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.