Transcript: Human NM_001354285.2

Homo sapiens signal induced proliferation associated 1 like 1 (SIPA1L1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SIPA1L1 (26037)
Length:
8015
CDS:
553..5967

Additional Resources:

NCBI RefSeq record:
NM_001354285.2
NBCI Gene record:
SIPA1L1 (26037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147005 CCGTACAACTACCGAATAATT pLKO.1 2146 CDS 100% 15.000 21.000 N SIPA1L1 n/a
2 TRCN0000423652 CAAGTTTCCCTTCCGAAATAA pLKO_005 3726 CDS 100% 15.000 12.000 N SIPA1L1 n/a
3 TRCN0000429473 TCCGAACTCAACAGCTATAAC pLKO_005 4483 CDS 100% 13.200 10.560 N SIPA1L1 n/a
4 TRCN0000146641 CCACACTGATGATTTCTACAT pLKO.1 639 CDS 100% 4.950 3.960 N SIPA1L1 n/a
5 TRCN0000149349 GCAAAGAAGTGAGGATAGCAT pLKO.1 4164 CDS 100% 3.000 2.400 N SIPA1L1 n/a
6 TRCN0000433045 GATCTGGGTGCATACTATTAT pLKO_005 2008 CDS 100% 15.000 10.500 N SIPA1L1 n/a
7 TRCN0000149733 GCGGCACATTGGAAATGATAT pLKO.1 2661 CDS 100% 13.200 9.240 N SIPA1L1 n/a
8 TRCN0000416028 TAGCACATCTTCAATTGATAA pLKO_005 1173 CDS 100% 13.200 9.240 N SIPA1L1 n/a
9 TRCN0000149050 GCTCCTTTAGTGGATGTGAAA pLKO.1 1862 CDS 100% 4.950 3.465 N SIPA1L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354285.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.