Transcript: Human NM_001354449.2

Homo sapiens solute carrier family 4 member 10 (SLC4A10), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SLC4A10 (57282)
Length:
5485
CDS:
104..3367

Additional Resources:

NCBI RefSeq record:
NM_001354449.2
NBCI Gene record:
SLC4A10 (57282)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427887 AGCAACTGAAGGGCGTATAAG pLKO_005 1609 CDS 100% 13.200 18.480 N SLC4A10 n/a
2 TRCN0000020280 CCTTCTGATTACTGCCGATAA pLKO.1 3298 CDS 100% 10.800 15.120 N SLC4A10 n/a
3 TRCN0000020279 GCTGACACAATACTCGTGTAA pLKO.1 1993 CDS 100% 4.950 6.930 N SLC4A10 n/a
4 TRCN0000020283 CCCTAATGACAGATGAGGTAT pLKO.1 1188 CDS 100% 4.950 3.960 N SLC4A10 n/a
5 TRCN0000417678 ACAGTAATAGCTGCTATAATT pLKO_005 2447 CDS 100% 15.000 10.500 N SLC4A10 n/a
6 TRCN0000414294 GGGATCCAAGCATTCGAATAG pLKO_005 1305 CDS 100% 10.800 7.560 N SLC4A10 n/a
7 TRCN0000020282 CCTACGAGAAATGATGAAGAA pLKO.1 146 CDS 100% 4.950 3.465 N SLC4A10 n/a
8 TRCN0000020281 GCATTGATGAAACAGCATCAT pLKO.1 749 CDS 100% 0.495 0.347 N SLC4A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.