Transcript: Human NM_001354638.2

Homo sapiens exoribonuclease 1 (ERI1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ERI1 (90459)
Length:
1330
CDS:
168..1082

Additional Resources:

NCBI RefSeq record:
NM_001354638.2
NBCI Gene record:
ERI1 (90459)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433701 TGACTTCAGTGACCCGGTTTA pLKO_005 344 CDS 100% 10.800 15.120 N ERI1 n/a
2 TRCN0000007858 GCATCAGTCTAACTGGAATTA pLKO.1 724 CDS 100% 13.200 9.240 N ERI1 n/a
3 TRCN0000007855 GCTTGAAACTAGAGGAGTAAA pLKO.1 443 CDS 100% 13.200 9.240 N ERI1 n/a
4 TRCN0000420127 GTAATTGACTGGATGAAATTG pLKO_005 795 CDS 100% 13.200 9.240 N ERI1 n/a
5 TRCN0000420352 GTCAACTCAGCAGGCTCAAAT pLKO_005 895 CDS 100% 13.200 9.240 N ERI1 n/a
6 TRCN0000007857 GCCATTACGAATGGCTGTATT pLKO.1 375 CDS 100% 1.320 0.924 N ERI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.