Transcript: Human NM_001354926.1

Homo sapiens protein phosphatase 2 regulatory subunit B'epsilon (PPP2R5E), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
PPP2R5E (5529)
Length:
3398
CDS:
625..1056

Additional Resources:

NCBI RefSeq record:
NM_001354926.1
NBCI Gene record:
PPP2R5E (5529)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080772 GACACGCTATCTGATCTTAAA pLKO.1 856 CDS 100% 13.200 18.480 N Ppp2r5e n/a
2 TRCN0000002556 GTCGCAAAGTTCCTCACAGTT pLKO.1 711 CDS 100% 4.950 6.930 N PPP2R5E n/a
3 TRCN0000080770 CCTGAACTGTTCCTAAAGAAA pLKO.1 802 CDS 100% 5.625 3.938 N Ppp2r5e n/a
4 TRCN0000002557 CCTGAAGTAGTTAGAATGGTA pLKO.1 961 CDS 100% 3.000 2.100 N PPP2R5E n/a
5 TRCN0000272793 CCTGAAGTAGTTAGAATGGTA pLKO_005 961 CDS 100% 3.000 2.100 N PPP2R5E n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.