Transcript: Human NM_001354942.2

Homo sapiens cullin 4A (CUL4A), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
CUL4A (8451)
Length:
5817
CDS:
447..2291

Additional Resources:

NCBI RefSeq record:
NM_001354942.2
NBCI Gene record:
CUL4A (8451)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006529 GCCAAAGGTTAATGCAGGAAA pLKO.1 751 CDS 100% 4.950 6.930 N CUL4A n/a
2 TRCN0000320897 ACTGTTTAGAACCCATATTAT pLKO_005 539 CDS 100% 15.000 12.000 N CUL4A n/a
3 TRCN0000006527 CCATGATATGTGGTCTAAGAA pLKO.1 3618 3UTR 100% 5.625 4.500 N CUL4A n/a
4 TRCN0000320905 CTGATAGACAGAGACTATATG pLKO_005 2226 CDS 100% 13.200 9.240 N CUL4A n/a
5 TRCN0000320898 GGACAAGAAGATGTTACTAAA pLKO_005 2551 3UTR 100% 13.200 9.240 N CUL4A n/a
6 TRCN0000320827 GTGTGGAGAAACAGCTATTAG pLKO_005 877 CDS 100% 13.200 9.240 N CUL4A n/a
7 TRCN0000006528 GCAGGTGTATAAAGATTCATT pLKO.1 683 CDS 100% 5.625 3.938 N CUL4A n/a
8 TRCN0000006530 GCAGAACTGATCGCAAAGCAT pLKO.1 1227 CDS 100% 3.000 2.100 N CUL4A n/a
9 TRCN0000320896 GCAGAACTGATCGCAAAGCAT pLKO_005 1227 CDS 100% 3.000 2.100 N CUL4A n/a
10 TRCN0000006531 CCAGAATATCTTAACCATGTA pLKO.1 780 CDS 100% 4.950 2.970 N CUL4A n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4353 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4353 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354942.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.