Transcript: Mouse NM_001355601.1

Mus musculus transmembrane serine protease 6 (Tmprss6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Tmprss6 (71753)
Length:
3157
CDS:
211..2610

Additional Resources:

NCBI RefSeq record:
NM_001355601.1
NBCI Gene record:
Tmprss6 (71753)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001355601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032504 GCTTCCTATAAGACCGAATAT pLKO.1 739 CDS 100% 13.200 18.480 N Tmprss6 n/a
2 TRCN0000032505 GCAAGTGTACTACAGCTTGTA pLKO.1 1509 CDS 100% 4.950 6.930 N Tmprss6 n/a
3 TRCN0000032507 ACCCAATTTCTTTGGCGTCTA pLKO.1 2541 CDS 100% 4.050 5.670 N Tmprss6 n/a
4 TRCN0000032506 CCAGTTACTACTCTCCCAGTA pLKO.1 1244 CDS 100% 4.050 2.835 N Tmprss6 n/a
5 TRCN0000032508 GCTTTGGTATTTCCTAGGGTA pLKO.1 393 CDS 100% 2.640 1.848 N Tmprss6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355601.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.