Transcript: Mouse NM_001357467.1

Mus musculus tripartite motif-containing 30A (Trim30a), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Mus musculus (mouse)
Gene:
Trim30a (20128)
Length:
3809
CDS:
267..1757

Additional Resources:

NCBI RefSeq record:
NM_001357467.1
NBCI Gene record:
Trim30a (20128)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001357467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238458 CTAATGTGTTGTGGATATATA pLKO_005 3510 3UTR 100% 15.000 12.000 N Trim30a n/a
2 TRCN0000238459 ACTGCGGTGCTCTCATCTATA pLKO_005 1642 CDS 100% 13.200 9.240 N Trim30a n/a
3 TRCN0000238457 TGTTCAGAGCCAATGACTATA pLKO_005 1719 CDS 100% 13.200 9.240 N Trim30a n/a
4 TRCN0000040636 GAAATGCTGCAGGGTGCAAAT pLKO.1 1002 CDS 100% 10.800 7.560 N Trim30a n/a
5 TRCN0000238455 GAAGAGGTTGACCAAGAATAC pLKO_005 663 CDS 100% 10.800 7.560 N Trim30a n/a
6 TRCN0000040634 GCTCTGTGGAAGCTGATGAAA pLKO.1 702 CDS 100% 5.625 3.938 N Trim30a n/a
7 TRCN0000040637 GACCTTCAACTGCAGAGAGTT pLKO.1 753 CDS 100% 4.950 3.465 N Trim30a n/a
8 TRCN0000040635 CAACAGAAACACAGACGGGAA pLKO.1 401 CDS 100% 2.160 1.512 N Trim30a n/a
9 TRCN0000238456 GAGAACCAAATACAGATCAAT pLKO_005 780 CDS 100% 5.625 3.375 N Trim30a n/a
10 TRCN0000040633 GCAAGTGTATCAAGGACTCAT pLKO.1 1124 CDS 100% 4.950 2.970 N Trim30a n/a
11 TRCN0000041166 GCTCTTCTGTAGGAAGGACAT pLKO.1 578 CDS 100% 4.050 2.025 Y Trim12a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001357467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.