Transcript: Human NM_001358661.2

Homo sapiens chromosome 17 open reading frame 113 (C17orf113), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
C17orf113 (110806298)
Length:
3733
CDS:
233..2260

Additional Resources:

NCBI RefSeq record:
NM_001358661.2
NBCI Gene record:
C17orf113 (110806298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001358661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2917 3UTR 100% 4.950 2.475 Y LOC387873 n/a
2 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2881 3UTR 100% 4.950 2.475 Y n/a
3 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2788 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001358661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.