Transcript: Human NM_001359228.2

Homo sapiens SH2B adaptor protein 2 (SH2B2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SH2B2 (10603)
Length:
2236
CDS:
257..2155

Additional Resources:

NCBI RefSeq record:
NM_001359228.2
NBCI Gene record:
SH2B2 (10603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001359228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446938 ACATCACCCTTCGCAGCTATG pLKO_005 1779 CDS 100% 6.000 8.400 N SH2B2 n/a
2 TRCN0000180041 CCGAATACATCTTGGAGACCA pLKO.1 1101 CDS 100% 2.640 3.696 N SH2B2 n/a
3 TRCN0000179618 GCCAGAGAAGGATAACACATT pLKO.1 1057 CDS 100% 4.950 3.465 N SH2B2 n/a
4 TRCN0000180549 GTACGTGCTGACCTTCAACTT pLKO.1 1615 CDS 100% 4.950 3.465 N SH2B2 n/a
5 TRCN0000180371 GTCCTCAAGGTAGAGAATGGA pLKO.1 1079 CDS 100% 3.000 2.100 N SH2B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001359228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.