Transcript: Mouse NM_001362501.1

Mus musculus transient receptor potential cation channel, subfamily M, member 3 (Trpm3), transcript variant 20, mRNA.

Source:
NCBI, updated 2018-08-19
Taxon:
Mus musculus (mouse)
Gene:
Trpm3 (226025)
Length:
12346
CDS:
76..5244

Additional Resources:

NCBI RefSeq record:
NM_001362501.1
NBCI Gene record:
Trpm3 (226025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001362501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125531 CCTGGCATTTGGGCATAAATA pLKO.1 1263 CDS 100% 15.000 21.000 N Trpm3 n/a
2 TRCN0000125533 CGCTTCAATTCGTCCAACGAT pLKO.1 3745 CDS 100% 3.000 4.200 N Trpm3 n/a
3 TRCN0000125530 GCCGTCTTCAACAATACATTT pLKO.1 3448 CDS 100% 13.200 9.240 N Trpm3 n/a
4 TRCN0000125529 CCGCTCATCATGTGACCATTT pLKO.1 6300 3UTR 100% 10.800 7.560 N Trpm3 n/a
5 TRCN0000125532 CCTCAAGGTAATTCTGGGAAT pLKO.1 2436 CDS 100% 4.050 2.835 N Trpm3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362501.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.