Transcript: Human NM_001362668.1

Homo sapiens DnaJ heat shock protein family (Hsp40) member C2 (DNAJC2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
DNAJC2 (27000)
Length:
2457
CDS:
737..2164

Additional Resources:

NCBI RefSeq record:
NM_001362668.1
NBCI Gene record:
DNAJC2 (27000)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001362668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254056 ACGATTTGAAGGTCCATATAC pLKO_005 1924 CDS 100% 13.200 18.480 N DNAJC2 n/a
2 TRCN0000254054 AGCAGCTGGTGAACCAATAAA pLKO_005 623 5UTR 100% 15.000 10.500 N DNAJC2 n/a
3 TRCN0000254055 ACAGATCAAAGCAGCTCATAA pLKO_005 566 5UTR 100% 13.200 9.240 N DNAJC2 n/a
4 TRCN0000374143 ACAGATCAAAGCAGCTCATAA pLKO_005 566 5UTR 100% 13.200 9.240 N Dnajc2 n/a
5 TRCN0000254058 CTGGAAGAACCAAGATCATTA pLKO_005 500 5UTR 100% 13.200 9.240 N DNAJC2 n/a
6 TRCN0000254057 TACTTCACTTGCATAACTAAA pLKO_005 660 5UTR 100% 13.200 9.240 N DNAJC2 n/a
7 TRCN0000365966 TACTTCACTTGCATAACTAAA pLKO_005 660 5UTR 100% 13.200 9.240 N Dnajc2 n/a
8 TRCN0000374113 GAACTGCCAAAGATGTTATTA pLKO_005 1779 CDS 100% 15.000 10.500 N Dnajc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001362668.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.