Transcript: Human NM_001363113.1

Homo sapiens 1-aminocyclopropane-1-carboxylate synthase homolog (inactive) like (ACCSL), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-02
Taxon:
Homo sapiens (human)
Gene:
ACCSL (390110)
Length:
1867
CDS:
647..1810

Additional Resources:

NCBI RefSeq record:
NM_001363113.1
NBCI Gene record:
ACCSL (390110)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149246 GCCAAGAGGTATAACCTACAT pLKO.1 1145 CDS 100% 4.950 6.930 N ACCSL n/a
2 TRCN0000148936 CTATTGTTATCCCGTGGCAAA pLKO.1 1637 CDS 100% 4.050 5.670 N ACCSL n/a
3 TRCN0000149409 CCTGGACAACAAGCTATTGTT pLKO.1 1624 CDS 100% 0.563 0.450 N ACCSL n/a
4 TRCN0000416261 CCAGACTCACTGATGAAATAC pLKO_005 1115 CDS 100% 13.200 9.240 N ACCSL n/a
5 TRCN0000148779 CCTCTATGTCTGGATCAACTT pLKO.1 1546 CDS 100% 4.950 3.465 N ACCSL n/a
6 TRCN0000147529 GAACACAGAATGGATTGACAA pLKO.1 1423 CDS 100% 4.950 3.465 N ACCSL n/a
7 TRCN0000147272 GATCCCTGTACATTTGAAGAA pLKO.1 1580 CDS 100% 4.950 3.465 N ACCSL n/a
8 TRCN0000146406 CTGTTACAAACACCCATCCTT pLKO.1 978 CDS 100% 3.000 2.100 N ACCSL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363113.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.