Transcript: Human NM_001363140.2

Homo sapiens synuclein beta (SNCB), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
SNCB (6620)
Length:
1453
CDS:
320..724

Additional Resources:

NCBI RefSeq record:
NM_001363140.2
NBCI Gene record:
SNCB (6620)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188071 CAGGAGGAATATCAGGAGTAT pLKO.1 689 CDS 100% 4.950 6.930 N SNCB n/a
2 TRCN0000189197 GCTGAAGAACCACTGATTGAG pLKO.1 626 CDS 100% 4.950 3.960 N SNCB n/a
3 TRCN0000204111 GAGGAATATCAGGAGTATGAG pLKO.1 692 CDS 100% 4.950 3.465 N SNCB n/a
4 TRCN0000189047 GCTGCTGAAGAACCACTGATT pLKO.1 623 CDS 100% 4.950 2.970 N SNCB n/a
5 TRCN0000188488 CCAGGAGGAATATCAGGAGTA pLKO.1 688 CDS 100% 4.050 2.430 N SNCB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363140.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.