Transcript: Human NM_001363882.1

Homo sapiens FMR1 autosomal homolog 1 (FXR1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
FXR1 (8087)
Length:
8594
CDS:
615..1979

Additional Resources:

NCBI RefSeq record:
NM_001363882.1
NBCI Gene record:
FXR1 (8087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412665 TGGGATCCCTAACGTAATATT pLKO_005 2444 3UTR 100% 15.000 21.000 N FXR1 n/a
2 TRCN0000418419 AGATTGGTTCTAGGTCTTATA pLKO_005 1489 CDS 100% 13.200 18.480 N FXR1 n/a
3 TRCN0000161009 GAAACGGAATCTGAGCGTAAA pLKO.1 1587 CDS 100% 10.800 15.120 N FXR1 n/a
4 TRCN0000159365 GCTAAAGTTCGGATGATGAAA pLKO.1 603 5UTR 100% 5.625 7.875 N FXR1 n/a
5 TRCN0000165389 CGTAGACGAAGGACTGATGAA pLKO.1 1878 CDS 100% 4.950 6.930 N FXR1 n/a
6 TRCN0000160901 GCGAAGTATTCGTACGAAGTT pLKO.1 926 CDS 100% 4.950 6.930 N FXR1 n/a
7 TRCN0000421765 ACCTCCGGTTATGGTACAAAT pLKO_005 1545 CDS 100% 13.200 10.560 N FXR1 n/a
8 TRCN0000160812 CGCCAGGTTCCATTTAATGAA pLKO.1 477 5UTR 100% 5.625 4.500 N FXR1 n/a
9 TRCN0000165264 GAGAGGCGTGTGCTAATGAAA pLKO.1 772 CDS 100% 5.625 4.500 N FXR1 n/a
10 TRCN0000159153 GACGCTACTTACAATGAAATA pLKO.1 657 CDS 100% 13.200 9.240 N FXR1 n/a
11 TRCN0000158932 GCTAGAGGTTTCTTGGAATTT pLKO.1 1182 CDS 100% 13.200 9.240 N FXR1 n/a
12 TRCN0000164818 CCAGCGAATCTCATCACAGTA pLKO.1 1837 CDS 100% 4.950 3.465 N FXR1 n/a
13 TRCN0000166775 CCAGAAATGAAGAGGCCACTA pLKO.1 958 CDS 100% 4.050 2.835 N FXR1 n/a
14 TRCN0000159108 GCACTAAAGAAAGCATTGGAA pLKO.1 1375 CDS 100% 3.000 2.100 N FXR1 n/a
15 TRCN0000429352 GTATCATATTGCCTATCTAAA pLKO_005 1415 CDS 100% 13.200 7.920 N FXR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.