Transcript: Mouse NM_001364694.1

Mus musculus NADH:ubiquinone oxidoreductase core subunit S7 (Ndufs7), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-28
Taxon:
Mus musculus (mouse)
Gene:
Ndufs7 (75406)
Length:
719
CDS:
28..627

Additional Resources:

NCBI RefSeq record:
NM_001364694.1
NBCI Gene record:
Ndufs7 (75406)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001364694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041262 GCGCTATGACATGGACCGCTT pLKO.1 357 CDS 100% 0.720 1.008 N Ndufs7 n/a
2 TRCN0000363830 GCGCTATGACATGGACCGCTT pLKO_005 357 CDS 100% 0.720 1.008 N Ndufs7 n/a
3 TRCN0000041261 TGGCACGCTTACCAACAAGAT pLKO.1 429 CDS 100% 4.950 3.960 N Ndufs7 n/a
4 TRCN0000335039 TGGCACGCTTACCAACAAGAT pLKO_005 429 CDS 100% 4.950 3.960 N Ndufs7 n/a
5 TRCN0000041260 CACTACTCCTACTCGGTTGTT pLKO.1 541 CDS 100% 4.950 3.465 N Ndufs7 n/a
6 TRCN0000334967 CACTACTCCTACTCGGTTGTT pLKO_005 541 CDS 100% 4.950 3.465 N Ndufs7 n/a
7 TRCN0000041258 CGCAGAGTTCATCAGAGTGTA pLKO.1 100 CDS 100% 4.950 3.465 N Ndufs7 n/a
8 TRCN0000334965 CGCAGAGTTCATCAGAGTGTA pLKO_005 100 CDS 100% 4.950 3.465 N Ndufs7 n/a
9 TRCN0000041259 CAGGCTGATGTGATGATTGTA pLKO.1 406 CDS 100% 5.625 3.375 N Ndufs7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001364694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.