Transcript: Human NM_001365784.1

Homo sapiens ATPase plasma membrane Ca2+ transporting 4 (ATP2B4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ATP2B4 (493)
Length:
4326
CDS:
610..4104

Additional Resources:

NCBI RefSeq record:
NM_001365784.1
NBCI Gene record:
ATP2B4 (493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005782 CCGGACTATCTGCATAGCTTA pLKO.1 2514 CDS 100% 4.950 3.960 N ATP2B4 n/a
2 TRCN0000005785 CCTGATTCTATACTTTGTGAT pLKO.1 1740 CDS 100% 4.950 3.960 N ATP2B4 n/a
3 TRCN0000273589 GATGCACTGACCCAGATTAAT pLKO_005 724 CDS 100% 15.000 10.500 N ATP2B4 n/a
4 TRCN0000101866 CCCAAGACTTTCTTAGAATTA pLKO.1 877 CDS 100% 13.200 9.240 N Atp2b4 n/a
5 TRCN0000273588 GGGCATCCATTACCGTCAAAT pLKO_005 2058 CDS 100% 13.200 9.240 N ATP2B4 n/a
6 TRCN0000005783 GCCAGCACTATACCATTGTTT pLKO.1 3479 CDS 100% 5.625 3.938 N ATP2B4 n/a
7 TRCN0000285012 GCCAGCACTATACCATTGTTT pLKO_005 3479 CDS 100% 5.625 3.938 N ATP2B4 n/a
8 TRCN0000005784 GCTGAGATTGTGGTTGGTGAT pLKO.1 1219 CDS 100% 4.050 2.835 N ATP2B4 n/a
9 TRCN0000273587 GCTGAGATTGTGGTTGGTGAT pLKO_005 1219 CDS 100% 4.050 2.835 N ATP2B4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365784.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.