Transcript: Human NM_001366097.1

Homo sapiens zinc finger protein 654 (ZNF654), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
ZNF654 (55279)
Length:
6291
CDS:
719..3283

Additional Resources:

NCBI RefSeq record:
NM_001366097.1
NBCI Gene record:
ZNF654 (55279)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141490 CCGTACATCCAACCGATTTAA pLKO.1 2202 CDS 100% 15.000 21.000 N ZNF654 n/a
2 TRCN0000230399 CCGTACATCCAACCGATTTAA pLKO_005 2202 CDS 100% 15.000 21.000 N ZNF654 n/a
3 TRCN0000230398 CTTGGTTGTGTCCGGATATTT pLKO_005 2147 CDS 100% 15.000 21.000 N ZNF654 n/a
4 TRCN0000218502 CTGATCAAGATAACGTGTATA pLKO_005 3129 CDS 100% 13.200 10.560 N ZNF654 n/a
5 TRCN0000230400 ATCTAAGTACAGTCCTATTAA pLKO_005 4235 3UTR 100% 15.000 10.500 N ZNF654 n/a
6 TRCN0000141017 CCACAGATCAAGAAGGAAACT pLKO.1 2112 CDS 100% 4.950 3.465 N ZNF654 n/a
7 TRCN0000140664 CCTCCCAGTTACCTTGATGAA pLKO.1 3050 CDS 100% 4.950 3.465 N ZNF654 n/a
8 TRCN0000145207 GAACATGAAGCTCAACACTAT pLKO.1 2483 CDS 100% 4.950 3.465 N ZNF654 n/a
9 TRCN0000140723 GCAGCATGTTCAGTTTCGCTT pLKO.1 3541 3UTR 100% 2.640 1.848 N ZNF654 n/a
10 TRCN0000217981 TGCCAGTTTCTACTAGCAAAT pLKO_005 2625 CDS 100% 10.800 6.480 N ZNF654 n/a
11 TRCN0000141777 GAAGAGGATGAAGAAGGTGAT pLKO.1 2003 CDS 100% 4.050 2.025 Y ZNF654 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366097.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.