Transcript: Human NM_001366144.1

Homo sapiens transient receptor potential cation channel subfamily M member 3 (TRPM3), transcript variant 13, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TRPM3 (80036)
Length:
1538
CDS:
137..1294

Additional Resources:

NCBI RefSeq record:
NM_001366144.1
NBCI Gene record:
TRPM3 (80036)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426752 GAAGGCGGGTAGGTAACTTTC pLKO_005 1283 CDS 100% 10.800 15.120 N TRPM3 n/a
2 TRCN0000423742 CGAGGGTATGAGTGGATTATG pLKO_005 1341 3UTR 100% 13.200 10.560 N TRPM3 n/a
3 TRCN0000415993 GCGATGCCTTGAAGGATCATG pLKO_005 837 CDS 100% 4.950 3.960 N TRPM3 n/a
4 TRCN0000430388 GCATGCATTCCCACTTCATTC pLKO_005 1002 CDS 100% 10.800 7.560 N TRPM3 n/a
5 TRCN0000419737 TTCCTGTGGTGGCACTCATAG pLKO_005 1131 CDS 100% 10.800 7.560 N TRPM3 n/a
6 TRCN0000044259 CCCAATGTGATCTCGATTGTT pLKO.1 1163 CDS 100% 5.625 3.938 N TRPM3 n/a
7 TRCN0000044261 AGGGCTCATCAAAGCAGCAAT pLKO.1 757 CDS 100% 4.950 3.465 N TRPM3 n/a
8 TRCN0000044258 CGAGGAAAGATATGCACCATA pLKO.1 869 CDS 100% 4.950 3.465 N TRPM3 n/a
9 TRCN0000044260 GCATATTTCACTCCAGAAGAT pLKO.1 1087 CDS 100% 4.950 3.465 N TRPM3 n/a
10 TRCN0000044262 GATGACCAAGGAATGGCAGTT pLKO.1 652 CDS 100% 4.050 2.835 N TRPM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.