Transcript: Human NM_001366286.1

Homo sapiens T-box transcription factor T (TBXT), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TBXT (6862)
Length:
2396
CDS:
413..1723

Additional Resources:

NCBI RefSeq record:
NM_001366286.1
NBCI Gene record:
TBXT (6862)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005484 CGAGGAGATCACAGCTCTTAA pLKO.1 1012 CDS 100% 13.200 10.560 N TBXT n/a
2 TRCN0000005483 GCATAAGTATGAGCCTCGAAT pLKO.1 901 CDS 100% 4.950 3.960 N TBXT n/a
3 TRCN0000005480 GCTAATCTCTTGTGTTGTTAA pLKO.1 2272 3UTR 100% 13.200 9.240 N TBXT n/a
4 TRCN0000430578 GTCCTACTTTAGTGAGATAAA pLKO_005 2096 3UTR 100% 13.200 9.240 N TBXT n/a
5 TRCN0000005481 CGAATCCACATAGTGAGAGTT pLKO.1 917 CDS 100% 4.950 3.465 N TBXT n/a
6 TRCN0000005482 GCATGTTTATCCATGCTGCAA pLKO.1 1340 CDS 100% 0.264 0.185 N TBXT n/a
7 TRCN0000436140 TAGTTAGAGTTGAGCTGTTAA pLKO_005 2154 3UTR 100% 13.200 7.920 N TBXT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366286.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.