Transcript: Human NM_001366595.1

Homo sapiens serine and arginine repetitive matrix 1 (SRRM1), transcript variant 42, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
SRRM1 (10250)
Length:
3777
CDS:
26..2782

Additional Resources:

NCBI RefSeq record:
NM_001366595.1
NBCI Gene record:
SRRM1 (10250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000134 GCAGTCAAACCGTACAAGAAA pLKO.1 1279 CDS 100% 5.625 7.875 N SRRM1 n/a
2 TRCN0000000131 AGACGCCAATACAGACGACAA pLKO.1 1469 CDS 100% 4.050 5.670 N SRRM1 n/a
3 TRCN0000315192 GAGTTATCTGAATCGGAAGAA pLKO_005 1406 CDS 100% 4.950 3.960 N SRRM1 n/a
4 TRCN0000335883 AGCCCATCACCGCCAAGAAAT pLKO_005 2450 CDS 100% 13.200 9.240 N SRRM1 n/a
5 TRCN0000335884 CAGGGAGAACTTCAGGTAAAG pLKO_005 1320 CDS 100% 10.800 7.560 N SRRM1 n/a
6 TRCN0000000133 GACGCCAATACAGACGACAAA pLKO.1 1470 CDS 100% 4.950 3.465 N SRRM1 n/a
7 TRCN0000000132 CCACAACCAAACAAACGGCAT pLKO.1 2093 CDS 100% 2.160 1.512 N SRRM1 n/a
8 TRCN0000315275 CCACAACCAAACAAACGGCAT pLKO_005 2093 CDS 100% 2.160 1.512 N SRRM1 n/a
9 TRCN0000305336 GTTTGAGCTTTAGACTATAAC pLKO_005 2854 3UTR 100% 13.200 6.600 Y Srrm1 n/a
10 TRCN0000315211 GTTTGAGCTTTAGACTATAAC pLKO_005 2854 3UTR 100% 13.200 6.600 Y SRRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366595.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.