Transcript: Human NM_001366795.1

Homo sapiens calbindin 1 (CALB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-11
Taxon:
Homo sapiens (human)
Gene:
CALB1 (793)
Length:
2458
CDS:
183..893

Additional Resources:

NCBI RefSeq record:
NM_001366795.1
NBCI Gene record:
CALB1 (793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053678 CGAACGGATCTTGCTCTTATT pLKO.1 852 CDS 100% 13.200 18.480 N CALB1 n/a
2 TRCN0000413850 TAAACAGGATCTGGATATTAA pLKO_005 773 CDS 100% 15.000 10.500 N CALB1 n/a
3 TRCN0000422497 TGATGGGAAGCTGGAATTAAC pLKO_005 581 CDS 100% 13.200 9.240 N CALB1 n/a
4 TRCN0000053681 CAGACCTAATGCTGAAACTAT pLKO.1 547 CDS 100% 5.625 3.938 N CALB1 n/a
5 TRCN0000053682 GCAATGGATACATAGATGAAA pLKO.1 712 CDS 100% 5.625 3.938 N CALB1 n/a
6 TRCN0000053680 TCTTCTTAAATTCCAGGGAAT pLKO.1 638 CDS 100% 4.050 2.835 N CALB1 n/a
7 TRCN0000425274 TAGTGATACACTGTATCTAAA pLKO_005 917 3UTR 100% 13.200 7.920 N CALB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366795.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.