Transcript: Human NM_001366888.1

Homo sapiens glycosyltransferase 1 domain containing 1 (GLT1D1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
GLT1D1 (144423)
Length:
2728
CDS:
218..850

Additional Resources:

NCBI RefSeq record:
NM_001366888.1
NBCI Gene record:
GLT1D1 (144423)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244006 GGATTTAGAAGTACCGGTATT pLKO_005 595 CDS 100% 10.800 15.120 N GLT1D1 n/a
2 TRCN0000257200 TGGTTAGTGATCCTGCATTAG pLKO_005 714 CDS 100% 10.800 15.120 N GLT1D1 n/a
3 TRCN0000244005 GTGGACAATAGAGGCTTATTT pLKO_005 1171 3UTR 100% 15.000 10.500 N GLT1D1 n/a
4 TRCN0000146929 CCTCCACTGAATACTGAAATT pLKO.1 1831 3UTR 100% 13.200 9.240 N GLT1D1 n/a
5 TRCN0000244007 ATACGTGAGAATGTATCATTC pLKO_005 763 CDS 100% 10.800 7.560 N GLT1D1 n/a
6 TRCN0000148269 GCCTCCATCATGTAATAGAAT pLKO.1 2231 3UTR 100% 5.625 3.938 N GLT1D1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.