Transcript: Human NM_001366910.1

Homo sapiens transmembrane protein 145 (TMEM145), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-03-22
Taxon:
Homo sapiens (human)
Gene:
TMEM145 (284339)
Length:
2298
CDS:
69..1760

Additional Resources:

NCBI RefSeq record:
NM_001366910.1
NBCI Gene record:
TMEM145 (284339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001366910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432005 CTATGGGAACGTGACGTTTAT pLKO_005 1433 CDS 100% 13.200 18.480 N TMEM145 n/a
2 TRCN0000421821 ACGACACTTCTCCGCTGATGA pLKO_005 590 CDS 100% 4.950 6.930 N TMEM145 n/a
3 TRCN0000161798 CAGTTGCTCCACACAACTTAT pLKO.1 705 CDS 100% 1.320 1.056 N TMEM145 n/a
4 TRCN0000215940 CTCTTGTTACTTTGGATATTT pLKO.1 671 CDS 100% 15.000 10.500 N Tmem145 n/a
5 TRCN0000134920 CTTCTTCCTCTCTTGTTACTT pLKO.1 662 CDS 100% 5.625 3.938 N TMEM145 n/a
6 TRCN0000164448 CCATGGCGTGTTTCTGATCAT pLKO.1 1289 CDS 100% 4.950 3.465 N TMEM145 n/a
7 TRCN0000138662 CTCATCTTCCTGCTGATGCTT pLKO.1 864 CDS 100% 3.000 2.100 N TMEM145 n/a
8 TRCN0000138514 CCTGATTGCCAATTTCGGCAT pLKO.1 1208 CDS 100% 2.160 1.512 N TMEM145 n/a
9 TRCN0000161899 GTCAGAACATCCTCCTCTATT pLKO.1 274 CDS 100% 13.200 7.920 N TMEM145 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001366910.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.