Transcript: Human NM_001367390.1

Homo sapiens DEAF1 transcription factor (DEAF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DEAF1 (10522)
Length:
2238
CDS:
950..1921

Additional Resources:

NCBI RefSeq record:
NM_001367390.1
NBCI Gene record:
DEAF1 (10522)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020361 CTGATTGTCGTCCACACAGAT pLKO.1 665 5UTR 100% 4.950 6.930 N DEAF1 n/a
2 TRCN0000020363 GTACCTAGAAGAGATGGTCAA pLKO.1 1585 CDS 100% 0.000 0.000 N DEAF1 n/a
3 TRCN0000232489 GAAGGAGCAGTCCTGCGTTAA pLKO_005 1720 CDS 100% 10.800 8.640 N DEAF1 n/a
4 TRCN0000232490 CAAGTCATTAACACACTTTAA pLKO_005 2053 3UTR 100% 13.200 9.240 N DEAF1 n/a
5 TRCN0000232486 TCATCCAGGATGGGATCTTAA pLKO_005 1020 CDS 100% 13.200 9.240 N DEAF1 n/a
6 TRCN0000232487 CTGCGACGACATGACCTTAAG pLKO_005 1075 CDS 100% 10.800 7.560 N DEAF1 n/a
7 TRCN0000020362 AGGCGCAAGAAGGAGAATGAA pLKO.1 1127 CDS 100% 5.625 3.938 N DEAF1 n/a
8 TRCN0000020360 TGGAAGGATCACCAGCACATA pLKO.1 1820 CDS 100% 4.950 3.465 N DEAF1 n/a
9 TRCN0000020359 CCCAAGAACATCACATTGCTT pLKO.1 1178 CDS 100% 3.000 2.100 N DEAF1 n/a
10 TRCN0000232488 TAGAGGCCACTGCTGTCATAT pLKO_005 1287 CDS 100% 13.200 7.920 N DEAF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367390.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.