Transcript: Human NM_001367474.1

Homo sapiens espin (ESPN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ESPN (83715)
Length:
3480
CDS:
181..2682

Additional Resources:

NCBI RefSeq record:
NM_001367474.1
NBCI Gene record:
ESPN (83715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136256 GCATGTTCGTTGACTATCAAA pLKO.1 2955 3UTR 100% 5.625 7.875 N ESPN n/a
2 TRCN0000136069 GCATGCCGACTTACATATATT pLKO.1 2933 3UTR 100% 15.000 10.500 N ESPN n/a
3 TRCN0000136491 CTGACGCAAACAACAACAAAT pLKO.1 2901 3UTR 100% 13.200 9.240 N ESPN n/a
4 TRCN0000137395 GAGTGCAGGACAAAGACAATT pLKO.1 467 CDS 100% 13.200 9.240 N ESPN n/a
5 TRCN0000137925 GAAGGAACAGTCAGAGAAGCT pLKO.1 2577 CDS 100% 2.640 1.848 N ESPN n/a
6 TRCN0000135220 CCAAGTCTTTCAACATGATGT pLKO.1 2036 CDS 100% 4.950 2.970 N ESPN n/a
7 TRCN0000137363 GCACCAAGTCTTTCAACATGA pLKO.1 2033 CDS 100% 4.950 2.970 N ESPN n/a
8 TRCN0000136980 CTACATGCAGACCAAGAACAA pLKO.1 1587 CDS 100% 4.950 2.475 Y ESPN n/a
9 TRCN0000137898 GAGCTACATGGACATGCTGAA pLKO.1 1404 CDS 100% 4.050 2.025 Y ESPN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367474.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.