Transcript: Human NM_001367498.1

Homo sapiens contactin associated protein like 5 (CNTNAP5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
CNTNAP5 (129684)
Length:
11219
CDS:
365..4288

Additional Resources:

NCBI RefSeq record:
NM_001367498.1
NBCI Gene record:
CNTNAP5 (129684)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119253 GCGAGTGTAAACGGGAATATT pLKO.1 4260 CDS 100% 15.000 21.000 N CNTNAP5 n/a
2 TRCN0000119254 GCGACAAACTACAACTGTGAT pLKO.1 437 CDS 100% 4.950 6.930 N CNTNAP5 n/a
3 TRCN0000119255 CGGAAGTAGAGTTCAGGGTTA pLKO.1 3750 CDS 100% 4.050 5.670 N CNTNAP5 n/a
4 TRCN0000416228 ACTGATACCGACAGATCAAAC pLKO_005 2660 CDS 100% 10.800 7.560 N CNTNAP5 n/a
5 TRCN0000119252 GCATGGAAATAGCAGCTTGAA pLKO.1 5000 3UTR 100% 4.950 3.465 N CNTNAP5 n/a
6 TRCN0000119256 GTGCAGATTTATTCTGGAAAT pLKO.1 1805 CDS 100% 10.800 6.480 N CNTNAP5 n/a
7 TRCN0000412699 GTGATAGCAGTGGTGATATTT pLKO_005 4094 CDS 100% 15.000 7.500 Y CNTNAP3 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5197 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.