Transcript: Human NM_001367857.2

Homo sapiens spermidine/spermine N1-acetyl transferase like 1 (SATL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SATL1 (340562)
Length:
2821
CDS:
627..2714

Additional Resources:

NCBI RefSeq record:
NM_001367857.2
NBCI Gene record:
SATL1 (340562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035886 GCACGAACCAATCAAGTTTAT pLKO.1 640 CDS 100% 13.200 18.480 N SATL1 n/a
2 TRCN0000035888 GCAAACAAGCATGGATTACTT pLKO.1 2192 CDS 100% 5.625 3.938 N SATL1 n/a
3 TRCN0000035885 GCCAATCAAGTAAGAACCAAA pLKO.1 2011 CDS 100% 4.950 3.465 N SATL1 n/a
4 TRCN0000035884 GCCAATCATGTAAGAACCAAA pLKO.1 1327 CDS 100% 4.950 3.465 N SATL1 n/a
5 TRCN0000035887 GCATGAAACAACCAGGCACAT pLKO.1 1570 CDS 100% 4.050 2.835 N SATL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367857.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.