Transcript: Human NM_001367873.1

Homo sapiens SRY-box transcription factor 6 (SOX6), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SOX6 (55553)
Length:
9304
CDS:
458..2944

Additional Resources:

NCBI RefSeq record:
NM_001367873.1
NBCI Gene record:
SOX6 (55553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225810 CTCCGCTCATGATCCCAATTT pLKO_005 1251 CDS 100% 13.200 18.480 N Sox6 n/a
2 TRCN0000017988 CCAACACTTGTCAGTACCATT pLKO.1 626 CDS 100% 4.950 6.930 N SOX6 n/a
3 TRCN0000017989 GCCACACATTAAGCGACCAAT pLKO.1 2311 CDS 100% 4.950 6.930 N SOX6 n/a
4 TRCN0000085947 GTTCCCTATATTCCTTCCGAA pLKO.1 717 CDS 100% 2.640 3.696 N Sox6 n/a
5 TRCN0000085944 GCAGCTAAACTACAGCAGTAT pLKO.1 2213 CDS 100% 4.950 3.960 N Sox6 n/a
6 TRCN0000017992 CGGGAAACTGTCCTCCATAAA pLKO.1 2026 CDS 100% 13.200 9.240 N SOX6 n/a
7 TRCN0000430184 TGGTCTTAATTGTTTCGTAAA pLKO_005 3055 3UTR 100% 10.800 7.560 N SOX6 n/a
8 TRCN0000085945 CCAGCCCTGTAACTCAAGTTA pLKO.1 1686 CDS 100% 5.625 3.938 N Sox6 n/a
9 TRCN0000017990 CCAGTGAACTTCTTGGAGAAA pLKO.1 966 CDS 100% 4.950 3.465 N SOX6 n/a
10 TRCN0000017991 CGTGAGATAATGACCAGTGTT pLKO.1 782 CDS 100% 4.950 3.465 N SOX6 n/a
11 TRCN0000218408 ACATGCATAACTCCAACATTA pLKO_005 2391 CDS 100% 13.200 7.920 N Sox6 n/a
12 TRCN0000225809 CCTATATTCCTTCCGAAATAC pLKO_005 721 CDS 100% 13.200 7.920 N Sox6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.