Transcript: Human NM_001367969.1

Homo sapiens phospholipase A2 group IIC (PLA2G2C), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
PLA2G2C (391013)
Length:
1462
CDS:
77..526

Additional Resources:

NCBI RefSeq record:
NM_001367969.1
NBCI Gene record:
PLA2G2C (391013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050761 CTACCAGTTCCACATCGTCAA pLKO.1 325 CDS 100% 4.050 5.670 N PLA2G2C n/a
2 TRCN0000050759 CCTTCTTCTCATATTACGGAT pLKO.1 180 CDS 100% 2.640 3.696 N PLA2G2C n/a
3 TRCN0000050758 CGAAGTGCCTTCTTCTCATAT pLKO.1 173 CDS 100% 13.200 9.240 N PLA2G2C n/a
4 TRCN0000050760 CCAGCCTGTGTTGAACAGCTA pLKO.1 307 CDS 100% 2.640 1.848 N PLA2G2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.