Transcript: Human NM_001367975.1

Homo sapiens BTG anti-proliferation factor 4 (BTG4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
BTG4 (54766)
Length:
1242
CDS:
233..922

Additional Resources:

NCBI RefSeq record:
NM_001367975.1
NBCI Gene record:
BTG4 (54766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117912 GCACTCTGATTGCCCTTCTAA pLKO.1 370 CDS 100% 5.625 7.875 N BTG4 n/a
2 TRCN0000129567 GCACTCTGATTGCCCTTCTAA pLKO.1 370 CDS 100% 5.625 7.875 N BTG4 n/a
3 TRCN0000129303 CTCCTGGGAAACACTTACCAT pLKO.1 821 CDS 100% 3.000 4.200 N BTG4 n/a
4 TRCN0000117915 CCGAAGAGTATTTATCAGGTT pLKO.1 725 CDS 100% 2.640 3.696 N BTG4 n/a
5 TRCN0000127642 CAGGTGCATCAGGATAAACAA pLKO.1 403 CDS 100% 5.625 4.500 N BTG4 n/a
6 TRCN0000117914 CCCTTTCAATCTTGGTTACAA pLKO.1 761 CDS 100% 5.625 4.500 N BTG4 n/a
7 TRCN0000117916 CACTCTGATTGCCCTTCTAAA pLKO.1 371 CDS 100% 13.200 9.240 N BTG4 n/a
8 TRCN0000130816 GAACCTCGTGTCATTCCTAAA pLKO.1 695 CDS 100% 10.800 7.560 N BTG4 n/a
9 TRCN0000129734 CTTTGTCACAAGATTGGTGAA pLKO.1 262 CDS 100% 4.050 2.835 N BTG4 n/a
10 TRCN0000117913 CGATGAAGAAAGTTGTAGCAA pLKO.1 673 CDS 100% 3.000 2.100 N BTG4 n/a
11 TRCN0000129673 CGATGAAGAAAGTTGTAGCAA pLKO.1 673 CDS 100% 3.000 2.100 N BTG4 n/a
12 TRCN0000127866 GCGATGAAGAAAGTTGTAGCA pLKO.1 672 CDS 100% 2.640 1.848 N BTG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367975.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.