Transcript: Human NM_001367993.1

Homo sapiens integrin subunit alpha 7 (ITGA7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ITGA7 (3679)
Length:
3934
CDS:
358..3444

Additional Resources:

NCBI RefSeq record:
NM_001367993.1
NBCI Gene record:
ITGA7 (3679)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001367993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057708 CCCAGGAACCTATAATTGGAA pLKO.1 666 CDS 100% 3.000 4.200 N ITGA7 n/a
2 TRCN0000057709 GCCCTGGACTATGTGTTAGAT pLKO.1 1597 CDS 100% 5.625 3.938 N ITGA7 n/a
3 TRCN0000057710 CTCAACATCATGTGGCCTCAT pLKO.1 2611 CDS 100% 4.050 2.835 N ITGA7 n/a
4 TRCN0000057711 GTCCTCCATAAAGAACTTGAT pLKO.1 3045 CDS 100% 4.950 2.970 N ITGA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001367993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.