Transcript: Human NM_001369654.1

Homo sapiens zinc finger DBF-type containing 2 (ZDBF2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-04-13
Taxon:
Homo sapiens (human)
Gene:
ZDBF2 (57683)
Length:
10329
CDS:
431..7495

Additional Resources:

NCBI RefSeq record:
NM_001369654.1
NBCI Gene record:
ZDBF2 (57683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247720 TCAACCCAAAGTAGCTATTAA pLKO_005 3817 CDS 100% 15.000 21.000 N ZDBF2 n/a
2 TRCN0000247721 TTAGCAGTAAACCCGAATAAA pLKO_005 1346 CDS 100% 15.000 21.000 N ZDBF2 n/a
3 TRCN0000247719 GGATAATGATATTCGGTTTAT pLKO_005 6535 CDS 100% 13.200 18.480 N ZDBF2 n/a
4 TRCN0000246345 GATAAGAGCTGTGGATATAAT pLKO_005 5393 CDS 100% 15.000 10.500 N ZDBF2 n/a
5 TRCN0000247722 TAGTTGCAAAGCAGCATATAT pLKO_005 9242 3UTR 100% 15.000 10.500 N ZDBF2 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8573 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8573 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369654.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.