Transcript: Human NM_001369873.1

Homo sapiens tight junction protein 2 (TJP2), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
TJP2 (9414)
Length:
4175
CDS:
97..3345

Additional Resources:

NCBI RefSeq record:
NM_001369873.1
NBCI Gene record:
TJP2 (9414)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148019 AAAGATGGCAACCTTCACGA pXPR_003 AGG 1034 32% 6 0.8337 TJP2 TJP2 77828
2 BRDN0001147569 AGGACGAAGAAAAGTTCTCG pXPR_003 GGG 1477 45% 10 0.0066 TJP2 TJP2 77827
3 BRDN0001145932 TTTCAGAGGATTAGTGCGGG pXPR_003 AGG 1702 52% 12 -0.6987 TJP2 TJP2 77829
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315436 ATAGAGTCAAACCGATCATTT pLKO_005 1318 CDS 100% 13.200 18.480 N TJP2 n/a
2 TRCN0000006166 CGGTTAAATACCGTGAGGCAA pLKO.1 2419 CDS 100% 2.640 2.112 N TJP2 n/a
3 TRCN0000006163 CCAGCTTAATAGCTGTAGTTT pLKO.1 3890 3UTR 100% 0.563 0.450 N TJP2 n/a
4 TRCN0000356774 GGCAATGATGTCGGGATATTT pLKO_005 1678 CDS 100% 15.000 10.500 N TJP2 n/a
5 TRCN0000356775 AGCAATATATGGCCCTAATAC pLKO_005 1605 CDS 100% 13.200 9.240 N TJP2 n/a
6 TRCN0000350445 CCTACCTTTGGGCGGTCTATA pLKO_005 2899 CDS 100% 13.200 9.240 N TJP2 n/a
7 TRCN0000315397 GCTTTAGGCAGAGCCATAATG pLKO_005 3840 3UTR 100% 13.200 9.240 N TJP2 n/a
8 TRCN0000006164 CGAGTGGTAGACACACTGTAT pLKO.1 1990 CDS 100% 4.950 3.465 N TJP2 n/a
9 TRCN0000006167 CGTCATCAGTATTCTGATTAT pLKO.1 1354 CDS 100% 1.320 0.924 N TJP2 n/a
10 TRCN0000315435 CGTCATCAGTATTCTGATTAT pLKO_005 1354 CDS 100% 1.320 0.924 N TJP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369873.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.