Transcript: Human NM_001370064.1

Homo sapiens ubiquitin associated protein 2 (UBAP2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
UBAP2 (55833)
Length:
4154
CDS:
257..3343

Additional Resources:

NCBI RefSeq record:
NM_001370064.1
NBCI Gene record:
UBAP2 (55833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004474 GCATCAAATACTCACAACATA pLKO.1 668 CDS 100% 5.625 7.875 N UBAP2 n/a
2 TRCN0000004472 CGTGGAAACAACAACCGGAAA pLKO.1 536 CDS 100% 4.050 5.670 N UBAP2 n/a
3 TRCN0000314598 GATGGGAGCCTAGCTAATAAT pLKO_005 2543 CDS 100% 15.000 12.000 N UBAP2 n/a
4 TRCN0000314599 AGAACACACGAGCACGTATTT pLKO_005 3392 3UTR 100% 13.200 10.560 N UBAP2 n/a
5 TRCN0000314540 AGCAGATGTCACAGGATTAAA pLKO_005 1561 CDS 100% 15.000 10.500 N UBAP2 n/a
6 TRCN0000241147 ATGTGAACAAAGCTATCAATA pLKO_005 384 CDS 100% 13.200 9.240 N Ubap2 n/a
7 TRCN0000350452 ATGTGAACAAAGCTATCAATA pLKO_005 384 CDS 100% 13.200 9.240 N UBAP2 n/a
8 TRCN0000314597 ACGGCTACAGTACAGGTTATG pLKO_005 2865 CDS 100% 10.800 7.560 N UBAP2 n/a
9 TRCN0000010880 GCAGACACTAGACACTCCAAA pLKO.1 1939 CDS 100% 4.950 3.465 N UBAP2 n/a
10 TRCN0000004473 CCACCTAATAAAGTTCTGAGA pLKO.1 4129 3UTR 100% 2.640 1.848 N UBAP2 n/a
11 TRCN0000216377 GTGAACAAAGCTATCAATATA pLKO.1 386 CDS 100% 15.000 9.000 N Ubap2 n/a
12 TRCN0000004475 CCACAGCCCAAACACATCAAA pLKO.1 1475 CDS 100% 5.625 3.375 N UBAP2 n/a
13 TRCN0000216004 CAATGAAGAATCACGACTTAT pLKO.1 3740 3UTR 100% 13.200 9.240 N Ubap2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.