Transcript: Human NM_001370142.1

Homo sapiens lysine acetyltransferase 6B (KAT6B), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KAT6B (23522)
Length:
7368
CDS:
445..5790

Additional Resources:

NCBI RefSeq record:
NM_001370142.1
NBCI Gene record:
KAT6B (23522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222166 GCACGGACTTTAACGATGCAA pLKO.1 5434 CDS 100% 3.000 4.200 N KAT6B n/a
2 TRCN0000039342 CCATTAAGTAACACAGGGCTT pLKO.1 5122 CDS 100% 2.160 3.024 N Kat6b n/a
3 TRCN0000287463 CCATTAAGTAACACAGGGCTT pLKO_005 5122 CDS 100% 2.160 3.024 N Kat6b n/a
4 TRCN0000245347 ACCGCAGTACAGGGTCAATTA pLKO_005 951 CDS 100% 13.200 9.240 N KAT6B n/a
5 TRCN0000245350 CTCGAACCCAGAGGTCTTAAT pLKO_005 3972 CDS 100% 13.200 9.240 N KAT6B n/a
6 TRCN0000222164 CCCTTGTAGAAACAATATGAA pLKO.1 3222 CDS 100% 5.625 3.938 N KAT6B n/a
7 TRCN0000222163 GCTGTGAATAATGGGAGGTTA pLKO.1 919 CDS 100% 4.950 3.465 N KAT6B n/a
8 TRCN0000245351 ATGGAAATGCCTCTAACTTTA pLKO_005 6662 3UTR 100% 13.200 7.920 N KAT6B n/a
9 TRCN0000039341 CCCACAGGAATATGCAAGATT pLKO.1 1782 CDS 100% 5.625 2.813 Y Kat6b n/a
10 TRCN0000287461 CCCACAGGAATATGCAAGATT pLKO_005 1782 CDS 100% 5.625 2.813 Y Kat6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.