Transcript: Human NM_001370157.1

Homo sapiens DPY30 domain containing 1 (DYDC1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DYDC1 (143241)
Length:
895
CDS:
413..841

Additional Resources:

NCBI RefSeq record:
NM_001370157.1
NBCI Gene record:
DYDC1 (143241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001370157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168239 CCAGTGGATCCGATAGAATAT pLKO.1 488 CDS 100% 13.200 18.480 N DYDC1 n/a
2 TRCN0000431636 GGAGCGTGAAAGAGAATTAGC pLKO_005 583 CDS 100% 4.950 6.930 N DYDC1 n/a
3 TRCN0000168307 GCCTGTTTAACTCAAGGTCTT pLKO.1 446 CDS 100% 4.050 5.670 N DYDC1 n/a
4 TRCN0000430792 CATTGTGGATTTACAAGTATA pLKO_005 513 CDS 100% 13.200 9.240 N DYDC1 n/a
5 TRCN0000167686 GCAAGGAGATGAGAATGAATA pLKO.1 750 CDS 100% 13.200 9.240 N DYDC1 n/a
6 TRCN0000168829 CAAGAACTACAGAGAGCTCAA pLKO.1 719 CDS 100% 4.050 2.835 N DYDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001370157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.